View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2225-Insertion-25 (Length: 319)
Name: NF2225-Insertion-25
Description: NF2225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2225-Insertion-25 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 8 - 319
Target Start/End: Original strand, 38877510 - 38877821
Alignment:
| Q |
8 |
ctaccagatattaataactctttgatattactcttctcaggttatctttgccgatggaaccttcattgatgggagtactagtgagctttcatgcgatgga |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38877510 |
ctaccagatattaataactctttaatattactcttctcaggttatctttgccgatggaaccttcattgatgggagtactagtgagctttcatgcgatgga |
38877609 |
T |
 |
| Q |
108 |
cctcttagagagccatttgctgtattttgccaggcatgttggttttgcatcgaacaacaatatactacatatgggtatgattcactattacatattaact |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38877610 |
cctcttagagagccatttgctgtattttgccaggcatgttggttttgcatcaaacaacaatatactacatatgggtatgattcactattacatattaact |
38877709 |
T |
 |
| Q |
208 |
tcatttgtttttcaaatgcagggtggcactcattggactcaatggggactagtcctaggagaagttctgaaatctattgatggaatctaaatttctataa |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38877710 |
tcatttgtttttcaaatgcagggtggcactcattggactcaatggggactagtcctaggagaagttctgaaatctattgatggaatctaaatttctataa |
38877809 |
T |
 |
| Q |
308 |
gttaatactaca |
319 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38877810 |
gttaatactaca |
38877821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University