View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2226R-Insertion-11 (Length: 372)
Name: NF2226R-Insertion-11
Description: NF2226R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2226R-Insertion-11 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 127 - 372
Target Start/End: Complemental strand, 8244392 - 8244146
Alignment:
| Q |
127 |
aaacagtcatgcacaaattttgctcattttttaactgaggaacaaaatagtactctacaatggtttcatttgaggccatagtta-cctggattggtctac |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8244392 |
aaacagtcatgcacaaattttgctcattttttaactgaggaacaaaatagtactctacaatggtttcatttgaggccatagttaacctggattggtctac |
8244293 |
T |
|
| Q |
226 |
ttggtcattaggtgaaaattttagccataagatatttagcatcattctttgataacagagaaaaactaacttctgtttgatttcatagttcagtcgtacc |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8244292 |
ttggtcattaggtgaaaattttagccataagatatttaggatcattctttgataacagagaaaaactaacttctgtttgatttcatagttcagtcgtaca |
8244193 |
T |
|
| Q |
326 |
tgtaatttttagaatttgaagatgctcattctgtcaccattcatttg |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8244192 |
tgtaatttttagaatttgaagatgctcattctgtcaccattcatttg |
8244146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 8244483 - 8244390
Alignment:
| Q |
8 |
attttcgtatgtttgagaaaatgaagattgtctgcacttgggttgcggtttgtattgaacttgatgggtttgcgcagaagtattttgaaacaaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8244483 |
attttcgtatgtttgagaaaatgaagattgtctgcacttgggttgcggtttgtattgaacttgatgggtttgcgcagaagtattttggaacaaa |
8244390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 38 - 129
Target Start/End: Complemental strand, 12832987 - 12832890
Alignment:
| Q |
38 |
tctgcacttgggttgcggtttgtattgaacttgatgggtttgcgcagaagtattttgaaacaa------attcagcatgttccagattggaaataaaa |
129 |
Q |
| |
|
||||| ||||| ||||||||| ||||||| ||| |||||||| ||||||||||| | ||||| ||||| ||||||| ||||||||||||||| |
|
|
| T |
12832987 |
tctgctcttggattgcggtttctattgaagttgtcgggtttgcacagaagtatttcggaacaaatttttattcaacatgttctagattggaaataaaa |
12832890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University