View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2227_high_2 (Length: 220)
Name: NF2227_high_2
Description: NF2227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2227_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 28 - 131
Target Start/End: Original strand, 25725389 - 25725491
Alignment:
| Q |
28 |
tgagtcaaactttacatatggatctatgttgttaagccccctttcatggttcacttttgtgcttttatcaaatgacaatcagaatagagaagatgatggg |
127 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| | |||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25725389 |
tgagtcaaactttacatatggatctatgtcgttaagcctcttttc-tggttcacttttgtgtttttatcaaatgacaattagaatagagaagatgatgga |
25725487 |
T |
 |
| Q |
128 |
aaat |
131 |
Q |
| |
|
|||| |
|
|
| T |
25725488 |
aaat |
25725491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 17 - 87
Target Start/End: Original strand, 4879416 - 4879485
Alignment:
| Q |
17 |
tgaaaattctttgagtcaaactttacatatggatctatgttgttaagccccctttcatggttcacttttgt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
4879416 |
tgaaaattctttgagtcaaactttacatatagatctatgttgttaag-ccccttttatggttcacttttgt |
4879485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 26 - 104
Target Start/End: Original strand, 9277556 - 9277633
Alignment:
| Q |
26 |
tttgagtcaaactttacatatggatctatgttgttaagccccctttcatggttcacttttgtgcttttatcaaatgaca |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||| |||| || |||||||||||| ||||||||||||||| |
|
|
| T |
9277556 |
tttgagtcaaactttacatatggatctatgtcgctaagccccttttc-tgattcacttttgtgtttttatcaaatgaca |
9277633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 28 - 87
Target Start/End: Original strand, 31713765 - 31713823
Alignment:
| Q |
28 |
tgagtcaaactttacatatggatctatgttgttaagccccctttcatggttcacttttgt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
31713765 |
tgagtcaaactttacatatggatctatgttgttaag-ccccttttatggttcacttttgt |
31713823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University