View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2228_high_10 (Length: 319)
Name: NF2228_high_10
Description: NF2228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2228_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 79 - 282
Target Start/End: Complemental strand, 13471380 - 13471176
Alignment:
| Q |
79 |
actaaattttgtcctttctatagtttctctctt-gtagatagctacataccataatatgcctgaatcagaaatctgtcaactgatgatactggtgatgaa |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13471380 |
actaaattttgtcctttctatagtttctctctttgtagatagctacataccataatatgcctgaatcagaaatctgtcaactgatgatactggtgatgaa |
13471281 |
T |
 |
| Q |
178 |
gccgtttttgatacataatttcatataaataataatcttccaaaggatatggtggtgaaaatcgataagcatgcatgcatgctaccctctctgctctgtc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13471280 |
gccgtttttgatacataatttcatataaataataatcttccaaaggatatggtggtgaaaatcgataagcatgcatgcatgctaccatctctgctctgtc |
13471181 |
T |
 |
| Q |
278 |
tctat |
282 |
Q |
| |
|
||||| |
|
|
| T |
13471180 |
tctat |
13471176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 15 - 53
Target Start/End: Complemental strand, 13471445 - 13471407
Alignment:
| Q |
15 |
aacatagggttgactacttgactcaatccaaatgtcatg |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13471445 |
aacatagggttgactacttgactcaatccaaatgtcatg |
13471407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University