View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2228_high_17 (Length: 236)
Name: NF2228_high_17
Description: NF2228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2228_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 1516171 - 1515951
Alignment:
| Q |
1 |
atccaaagaaagattaacacatacatggatatcgagtacagacactcatgttaatacatcaacatcgataataatttgaaaatttaaaattattaaaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1516171 |
atccaaagaaagattaacacatacatggatatcgagcac-gacactcatgttaatatatcaacatcgataataatttgaaagtttgaaattattaaaagt |
1516073 |
T |
|
| Q |
101 |
aaccacttatatgagtgtcagtgtcaggtcggacacactttcataaagatgttgtgattatggtattacgtaccttaagcttcttgggagcatatatgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1516072 |
aaccacttatatgagtgtcagtgtcaggtcggacacactttcatatagatgttgtgattatggtattacgtaccttaagcttcttgggagcatatatgat |
1515973 |
T |
|
| Q |
201 |
gtacatgattaagtatgcaact |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1515972 |
gtacatgattaagtatgcaact |
1515951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University