View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2228_high_18 (Length: 226)
Name: NF2228_high_18
Description: NF2228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2228_high_18 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 1516149 - 1516374
Alignment:
| Q |
1 |
tatgtgttaatctttctttggatttatatacctagaacatgagttagtacgattatatatataacgtgcggaaattaataaatgttttgatgaattgcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1516149 |
tatgtgttaatctttctttggatttatatacctagaacatgagttagtacgattatatatataacgtgcggaaattaataaatgttttgatgaattgcag |
1516248 |
T |
|
| Q |
101 |
atatccactttggtttttatacttgttgctgacctaggaggatttggcttgaccatgataatcaccttctttgtggtgaagtcctcctttcgtgttcatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1516249 |
atatccactttggtttttatacttgttgctgacctaggaggatttggcttgaccatgataatcaccttctttgtggtgaagtcctcctttcgtgttcatg |
1516348 |
T |
|
| Q |
201 |
ctgttgggttgatttgtgccattttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1516349 |
ctgttgggttgatttgtgccattttt |
1516374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 70 - 166
Target Start/End: Complemental strand, 40444646 - 40444550
Alignment:
| Q |
70 |
ggaaattaataaatgttttgatgaattgcagatatccactttggtttttatacttgttgctgacctaggaggatttggcttgaccatgataatcacc |
166 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||| |||| | ||||| ||||||||||| |||||||||||| |
|
|
| T |
40444646 |
ggaaattaattaatgttttgatgaattgcagatatccactttggttttgatacttattgttgacatgggaggttttggcttgacaatgataatcacc |
40444550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University