View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2228_high_19 (Length: 203)
Name: NF2228_high_19
Description: NF2228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2228_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 15 - 188
Target Start/End: Original strand, 10000421 - 10000594
Alignment:
| Q |
15 |
atgaacttatataaatgagcaagagagagaatattgcttatacaatcaagcaaagaaaaatcagtcacaatttattcaaacagacatatgaatgtgaaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10000421 |
atgaacttatataaatgagcaagagagagaatattgcttatacaatcaagcaaagaaaaatcagtcacaatttattcaaacagatatatgaatgtgaaat |
10000520 |
T |
 |
| Q |
115 |
gtctgttagcataccattgcataggcaactctcggctgtcaaaggtgggaggtaacattctccactttctgcat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10000521 |
gtctgttagcataccattgcataggcaactctcggttgtcaaaggtgggaggtaacattctccactttctgcat |
10000594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University