View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2228_low_23 (Length: 240)
Name: NF2228_low_23
Description: NF2228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2228_low_23 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 1395649 - 1395429
Alignment:
| Q |
20 |
ggcatgcccactatacatcttcaacttgtgaagaataacacaacactaaattttcattgttatagttttggcctcctcccttaactacataatatgcgaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1395649 |
ggcatgcccactatacatcttcaacttgtgaagaataacgcaacactaaattttcattgttatagttttggcctcctcccttaactacataatatgcgaa |
1395550 |
T |
 |
| Q |
120 |
tgattttgagctattcacatcttgagttgttgttgtatgtgtggtaatggtattcacctgctcaacattatttcctttccataatagttgctgaacctgg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
1395549 |
tgattttgagctattcacatcttgagttgttgttgtatgtgtggtaatggtattcacctgctcaacattattttctttccacaatagttgctgaacctgg |
1395450 |
T |
 |
| Q |
220 |
agtacatgatgcatttccttt |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1395449 |
agtacatgatgcatttccttt |
1395429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University