View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2229_high_19 (Length: 218)
Name: NF2229_high_19
Description: NF2229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2229_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 52109107 - 52109297
Alignment:
| Q |
16 |
gtgattaaagtatattgaggaattttcttcttgtgaacattgatttgacagtggaagtgaagcactgagtgcagaaatatggagtgtggtgaaaatgaag |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52109107 |
gtgatgaaagtatattgaggaattttcttcttgtgaacattgatttgacagtggaagtgaagcactgagtgcagaaatatggagtgtgatgaaaatgaag |
52109206 |
T |
 |
| Q |
116 |
aaggtggcttcaagtgtgaagaaaacagtgttcctaaagaaattttgaggtttcaaaagagtaatgaattaagcataagtcaccacaggtt |
206 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
52109207 |
aaggtgacttcaagtgtgaagaaaacagtgttcctaaagaaattttgaggtttcaaaagagtaatgaattaagcataattcaccaccggtt |
52109297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 26 - 98
Target Start/End: Original strand, 44526222 - 44526294
Alignment:
| Q |
26 |
tatattgaggaattttcttcttgtgaacattgatttgacagtggaagtgaagcactgagtgcagaaatatgga |
98 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||| || ||||||||||||||| |||||||| |||||| |
|
|
| T |
44526222 |
tatagtgaggaattttcttcttgtgagcattgatttgatagaggaagtgaagcactgggtgcagaattatgga |
44526294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University