View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2229_high_3 (Length: 354)
Name: NF2229_high_3
Description: NF2229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2229_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 33273171 - 33272836
Alignment:
| Q |
1 |
aggaaagggtttttccacaagcatggtgttgtatgtggaagattgggagatgtggttgatccaactagtgtttcgagggatggtcgtcgacaattagcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33273171 |
aggaaagggtttttccacaagcatggtgttgtatgtggaagattgggagatgtggttgatccaactagtgtttcgagggatggtcgtcgacaattagcta |
33273072 |
T |
 |
| Q |
101 |
agagtgtaccttctgctaagggttataaataaaggttcacaatcgcaatctagatcacaatataacaatttttatgttgccaaaattgtaaaacaatgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33273071 |
agagtgtaccttctgctaagggttataaataaaggttcacaatcgcaatctagatcacaatataacaatttttatgttgccaaaattgtaaaacaatgtg |
33272972 |
T |
 |
| Q |
201 |
attgaagttgcatccaccgtatttcactttgattttcacatatcaaagattataaggggatcgcaaccattaatatgcccggtatttaaaatccttgatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33272971 |
attgaagttgcatccaccgtatttcactttgattttcacatatcaaagattataaggggatcgcaaccattaatatgcccggtatttaaaatccttgatc |
33272872 |
T |
 |
| Q |
301 |
ttttttctaagctagttttatttggttaggcatata |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33272871 |
ttttttctaagctagttttatttggttaggcatata |
33272836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University