View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2229_low_1 (Length: 452)
Name: NF2229_low_1
Description: NF2229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2229_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 420; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 420; E-Value: 0
Query Start/End: Original strand, 19 - 442
Target Start/End: Original strand, 52033367 - 52033790
Alignment:
| Q |
19 |
gtggttccaggctacctctttgccaccttatcaattatttcatgggtttgttggatattccctaattcagtaacagcacatcaaattggatctgggaaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52033367 |
gtggttccaggctacctctttgccaccttatcaattatttcatgggtttgttggatattccctaattcagtaacagcacatcaaattggatctgggaaga |
52033466 |
T |
|
| Q |
119 |
atggccttggtttgggttccttttctcttgactggaccactattgcttcattccttgggaatccacttgttacccctatctttgcaacggttaacatcct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52033467 |
atggccttggtttgggttccttttctcttgactggaccactattgcttcattccttgggaatccacttgttacccctatctttgcaacggttaacatcct |
52033566 |
T |
|
| Q |
219 |
tgttggctacattttattaatctacattcttattccaacggcttattggggatttaatctctataatgccaaaaacttccccatatactctaatgaacta |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52033567 |
tgttggctacattttattaatctacattcttattccaacggcttattggggatttaatctctataatgccaaaaacttccccatatactctaatgaacta |
52033666 |
T |
|
| Q |
319 |
ttcactgctcaaggtgtgagatacaatgtgacagctattgtgaacaacaagtttgagatagatatggatgcatataataatcaaggtcacattaatatga |
418 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52033667 |
ttcagtgctcaaggtgtgagatacaatgtgacagctattgtgaacaacaagtttgagatagatatggatgcatataataatcaaggtcacattaatatga |
52033766 |
T |
|
| Q |
419 |
gtatcttcttttctatttcctatg |
442 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52033767 |
gtatcttcttttctatttcctatg |
52033790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University