View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2230_low_9 (Length: 368)
Name: NF2230_low_9
Description: NF2230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2230_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 3 - 353
Target Start/End: Complemental strand, 641939 - 641586
Alignment:
| Q |
3 |
ttgtatttgtgatcttacatggatttttgagcctttgttatatctgtgacactttgctcaagtcaaaagtcagttgaaaatttgaaacaatttttt-ata |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||| ||| |
|
|
| T |
641939 |
ttgtatttgtgatcttacatggatttttgagcctttgttatatctgtgacactttgatcaagtcaaaagtcatatgaaaatttgaaacactttttttata |
641840 |
T |
|
| Q |
102 |
tttgatggaccttttcactgatggaaaaagatgtgtgacnnnnnnnnn--gtaggaaagttgaagtgaattggattgatgtaaaatgcagagatcgcgta |
199 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
641839 |
tttgatggagcttttcactgatggaaaaagatgtgtgactttttttttttgtaggaaagttgaagtgaattggattgatgtaaaatgcagagatcgcgta |
641740 |
T |
|
| Q |
200 |
aagctcttcaacaaagaagatctttagagaaggctgcaagtgggcgaaattgtctttataaagtttctctgtctttggtttttattttgtggggattggt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
641739 |
aagctcttcaacaaagaagatctttagagaaggctgcaagtgggagaaattgtctttataaagtttctctgtctttggtttttattttgtggggattggt |
641640 |
T |
|
| Q |
300 |
tttcctcttcagcttatggataagttgtggcaacggatatggaggtatcttttt |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
641639 |
tttcctcttcagcttatggataagttgtggcaacggatatggaggtatcttttt |
641586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University