View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2232-Insertion-10 (Length: 101)
Name: NF2232-Insertion-10
Description: NF2232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2232-Insertion-10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 56; Significance: 9e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 9e-24
Query Start/End: Original strand, 8 - 85
Target Start/End: Original strand, 11629843 - 11629916
Alignment:
| Q |
8 |
atctgttcaacaataaacgagggacacaaagtattattactcatttcacaaaagtattcaacaaccattccattctac |
85 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11629843 |
atctgttcaacaataaacgagggaca-aaagtatt---actcatttcacaaaagtattcaacaaccattccattctac |
11629916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University