View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2232R-Insertion-13 (Length: 218)
Name: NF2232R-Insertion-13
Description: NF2232R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2232R-Insertion-13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 9 - 218
Target Start/End: Original strand, 49042369 - 49042578
Alignment:
| Q |
9 |
agttggaactgaacggtgaggaagagtaagagagggacgacgaatgtgaaaatgagaatggttgtggcattgcatgaatagccataacctaactttacgt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49042369 |
agttggaactgaacggtgaggaagagtaagagagggacgacgaatgtgaaaatgagaatggttgtggcattgcatgaatagccataacctaactttacgt |
49042468 |
T |
|
| Q |
109 |
acttgagtttcaccgtttgtagaaaatccggtaaacgtcgccggattttgataacggcggaggttgaatctttgaaatccatctccgccgttagtctttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49042469 |
acttgagtttcaccgtttgtagaaaatccggtaaacgtcgccggattttgataacggcggaggttgaatctttgaaatccatctccgccgttagtctttc |
49042568 |
T |
|
| Q |
209 |
tttatccatg |
218 |
Q |
| |
|
|||||||||| |
|
|
| T |
49042569 |
tttatccatg |
49042578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University