View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2232R-Insertion-14 (Length: 173)
Name: NF2232R-Insertion-14
Description: NF2232R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2232R-Insertion-14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 6e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 6e-82
Query Start/End: Original strand, 8 - 173
Target Start/End: Original strand, 50707564 - 50707729
Alignment:
| Q |
8 |
agatttttgtttggagaagtgatgatcagtgcggtttttgcattgcatagaatggataattctgttactttgttgaagagtcctagtttgcgctttgaaa |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50707564 |
agatttttgtttggtgaagtgatgatcagtgcggtttttgcattgcatagaatggataattctgttactttgttgaagagtcctagtttgcgctttgaaa |
50707663 |
T |
|
| Q |
108 |
aggtatcacggcgcttgttcgatggctttgctttcttgatttcaatggttctcttccgtgagttgc |
173 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50707664 |
aggtatcacgccgcttgttcgatggctttgctttcttgatttcaatggttttcttccgtgagttgc |
50707729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 70; Significance: 8e-32; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 8e-32
Query Start/End: Original strand, 16 - 157
Target Start/End: Original strand, 8167505 - 8167646
Alignment:
| Q |
16 |
gtttggagaagtgatgatcagtgcggtttttgcattgcatagaatggataattctgttactttgttgaagagtcctagtttgcgctttgaaaaggtatca |
115 |
Q |
| |
|
|||||| ||||||||||||| ||| ||||||||||||||||| || |||| |||||| |||||||||||||| ||||||||||| ||||| |||||||| |
|
|
| T |
8167505 |
gtttggtgaagtgatgatcattgcagtttttgcattgcataggatagatagttctgtaactttgttgaagagccctagtttgcgttttgagaaggtatcg |
8167604 |
T |
|
| Q |
116 |
cggcgcttgttcgatggctttgctttcttgatttcaatggtt |
157 |
Q |
| |
|
|| ||||||| ||| | | |||||||||||||| ||||||| |
|
|
| T |
8167605 |
aggggcttgtttgattgttctgctttcttgattttaatggtt |
8167646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 45 - 115
Target Start/End: Original strand, 8999198 - 8999268
Alignment:
| Q |
45 |
ttgcattgcatagaatggataattctgttactttgttgaagagtcctagtttgcgctttgaaaaggtatca |
115 |
Q |
| |
|
|||||||||||| |||| ||| || ||| ||||||||||||||||||| |||||| ||||| ||||||||| |
|
|
| T |
8999198 |
ttgcattgcataaaatgaatagttatgtgactttgttgaagagtcctaatttgcgttttgagaaggtatca |
8999268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University