View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2232_high_19 (Length: 251)
Name: NF2232_high_19
Description: NF2232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2232_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 51 - 227
Target Start/End: Complemental strand, 36179456 - 36179281
Alignment:
| Q |
51 |
aggtttgacaagcatgagtgttggaagaacacgcactagcagtgtctggtaatgagaatctacttgttagcataaactcgattaatcacccacttcgttt |
150 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
36179456 |
aggtttggcaagcataagtgttggaagaacacgcactagtagtgtctggtaatgagaatctacttgttagcataa-ctcgattaatcacccccttcgttt |
36179358 |
T |
|
| Q |
151 |
acttgtgtttgcgtgcttgcaatggcgtaaacaactcgcagcaatatgattaggtgaagttaatagcatgcttatcg |
227 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||| |
|
|
| T |
36179357 |
acttgtgtttgcctgcttgcaatggcgtaaacaactcgcagcaatataattaggtgaagtcaatagtatgcttatcg |
36179281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 7 - 65
Target Start/End: Complemental strand, 36179523 - 36179465
Alignment:
| Q |
7 |
atatgatctaagtgaagtgtgtttatgtagtcatgacataggtgaggtttgacaagcat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||| |
|
|
| T |
36179523 |
atatgatctaagtgaagtgtgtttatggagtcatgacataggtaaggtttaacaagcat |
36179465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University