View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2232_low_11 (Length: 388)
Name: NF2232_low_11
Description: NF2232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2232_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 135 - 369
Target Start/End: Original strand, 884852 - 885083
Alignment:
| Q |
135 |
gggaaagtgaagaaaaatcaagaaacttttgtcttatataaaaatatccacaagtggaaaggacccttttgccctttttaaagtcataagcttcaattac |
234 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
884852 |
gggatagtgaagaaaaatcaagaaacttttgtcttatataaaagtatccacaagtggaaaggacccttttgccctttttaaagtcataagcttcaattac |
884951 |
T |
|
| Q |
235 |
caaataacc--attctcatgaaggttgctcagatacacttaaaacactaataactaactatgttttaagc-ggatatttcattccctgtaacccattgga |
331 |
Q |
| |
|
||||||||| |||||||||||||||||||| || |||| ||| || ||| || ||||||||||| |||||||||||||||||| || ||||| |
|
|
| T |
884952 |
caaataaccatattctcatgaaggttgctcatatgtactt-aaagac-----actgaccatgttttaagcgggatatttcattccctgtggtccgttgga |
885045 |
T |
|
| Q |
332 |
ataatataatttgatcctgaaaaatcttatgcacaatt |
369 |
Q |
| |
|
|||||||| || || ||||||| | |||||||||||| |
|
|
| T |
885046 |
ataatatagttctattctgaaaagtgttatgcacaatt |
885083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 37
Target Start/End: Original strand, 884742 - 884775
Alignment:
| Q |
4 |
agaagcaaaggaggaacacgtgaaagaaatgggt |
37 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
884742 |
agaaggaaaggaggaacacgtgaaagaaatgggt |
884775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 327 - 369
Target Start/End: Complemental strand, 34149783 - 34149741
Alignment:
| Q |
327 |
ttggaataatataatttgatcctgaaaaatcttatgcacaatt |
369 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
34149783 |
ttggaataatatgattcgatcctgaaaattcttatgcacaatt |
34149741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University