View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2232_low_21 (Length: 267)
Name: NF2232_low_21
Description: NF2232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2232_low_21 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 34685153 - 34684886
Alignment:
| Q |
1 |
tggatgatgatgtaattgaaagagtagaaaaggggagggataaggtttcaaagccgaagaaatgtgaaatgttttgtttgattggaaaaatggtgatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34685153 |
tggatgatgatgtaattgaaagagtagaaaaggggagggataaggtttcaaagccgaagaaatgtgaaatgttttgtttgattggaaaaatggtgatgta |
34685054 |
T |
 |
| Q |
101 |
gttgcagttgtaaagttctttcttcaggttaatttgacgaaaaatgtgggnnnnnnnggattcatttgagagttgtatttaatttcttccgttatgtata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34685053 |
gttgcagttgtaaagttctttcttcaggttaatttgacgaaaaatgtgggtttttttggattcatttgagagttgtatttaatttcttccgttatgtata |
34684954 |
T |
 |
| Q |
201 |
gcatacatatcnnnnnnnaatttgactc-aaatgtattattcatgggagctttaatcttagccaattt |
267 |
Q |
| |
|
||||||||||| |||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34684953 |
gcatacatatctttttttaatttgactcgaattgtattattcatgggagctttaatcttagccaattt |
34684886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 92 - 149
Target Start/End: Complemental strand, 34693374 - 34693317
Alignment:
| Q |
92 |
ggtgatgtagttgcagttgtaaagttctttcttcaggttaatttgacgaaaaatgtgg |
149 |
Q |
| |
|
||||||||| || || ||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34693374 |
ggtgatgtaatttcaattgcaaagttctttcttcaggttatcttgacgaaaaatgtgg |
34693317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University