View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2232_low_22 (Length: 260)
Name: NF2232_low_22
Description: NF2232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2232_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 15056594 - 15056356
Alignment:
| Q |
1 |
gtaatgaaccacccatatatgtggggagcctatatggtttaaatgagtccccaatgagtataactaactcatgcacatctgagtgtaacaaaatttaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15056594 |
gtaatgaaccacccatatatgtggggagcctatatggtttaaatgagtccccaatgagtataactaactcatgcacatctgagtgtaacaaaatttaagg |
15056495 |
T |
 |
| Q |
101 |
cagatgaacatgcctatatggttcaagtgagattccaatatgtaggagcaacctagtagttcttcggttattgattatttatgctttgaggcgatggagc |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||| |||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
15056494 |
tagatgaacatgtctatatggttcaagtgagatcccaatatgcaggaacaacctagtagttcttcagttattgattatttatgctttaaggcgatggagc |
15056395 |
T |
 |
| Q |
201 |
gtgaaggcgctatgtcggtgtacgaggtggttcctaagg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15056394 |
gtgaaggcgctatgtcggtgtacgaggtgattcctaagg |
15056356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University