View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2232_low_29 (Length: 243)
Name: NF2232_low_29
Description: NF2232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2232_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 40639882 - 40639650
Alignment:
| Q |
1 |
ccattacaatgggaaacaccgctcaaatcaacgctagagtagattcaccttctttacggttttcatctttaaaccaactatacatgataataaaagggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40639882 |
ccattacaatgggaaacaccgctcaaatcaacgctagagtagattcaccttctttacggttttcatctttaaaccaactatacatgataataaaagggaa |
40639783 |
T |
|
| Q |
101 |
aacctattcataatagaagtgttttatattattagc-nnnnnnntaagtactttatattattaacaaaataaataataagcgttttatccatctgcatta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40639782 |
aacctattcataatagaagtgttttatatcattagcaaaaaaaataagtactttatattattaacaaaataaataataagcgttttatccatctgcatta |
40639683 |
T |
|
| Q |
200 |
gtcatgatagctcatcaatggtggcaaattcat |
232 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
40639682 |
gtcatgatagctcatcaattgtggcaaattcat |
40639650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 40643736 - 40643686
Alignment:
| Q |
182 |
ttttatccatctgcattagtcatgatagctcatcaatggtggcaaattcat |
232 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
40643736 |
ttttatccatctacattagtcatgatatctcatcaattgtggccaattcat |
40643686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University