View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2232_low_37 (Length: 203)
Name: NF2232_low_37
Description: NF2232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2232_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 8e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 40669186 - 40669372
Alignment:
| Q |
1 |
catgttgttgccattgaaaaatgattgcaaagttgaggtttcaagaataatatcgttgtcgggacgtccttgctgattcctgtaaaatatcttgccatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40669186 |
catgttgttgccattgaaaaatgattgcaaagttgaggtttcaagaataatatcgttgtcgggacgtccttgctgattcctgtaaaatatcttgccatga |
40669285 |
T |
 |
| Q |
101 |
aatgcatcgtggtggtaggaaattcgaagatggccgttagggtttgaaagcaagagttttatgttccattcggctgtgagttctgtg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
40669286 |
aatgcatcgtggtggtaggaaattcgaagatggccgttagggtttgaaagcaagagttttatgttccattcggctgagagttttgtg |
40669372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 81 - 187
Target Start/End: Original strand, 40662932 - 40663038
Alignment:
| Q |
81 |
tgtaaaatatcttgccatgaaatgcatcgtggtggtaggaaattcgaagatggccgttagggtttgaaagcaagagttttatgttccattcggctgtgag |
180 |
Q |
| |
|
|||||||||||||| || ||||| |||||||||||| || ||||| | |||| |||||||||||| || ||||| | || |||||||| |||||||| |
|
|
| T |
40662932 |
tgtaaaatatcttgggatcaaatgaatcgtggtggtatgagattcgcaaatggtagttagggtttgatagggagagtgtaattttccattcagctgtgag |
40663031 |
T |
 |
| Q |
181 |
ttctgtg |
187 |
Q |
| |
|
|| |||| |
|
|
| T |
40663032 |
ttttgtg |
40663038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University