View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2233_low_6 (Length: 232)
Name: NF2233_low_6
Description: NF2233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2233_low_6 |
 | |
|
| [»] scaffold0256 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 16875871 - 16875671
Alignment:
| Q |
14 |
attattctatggttctcagctgtttgattaggaatatgaaatttcaactatctattatgttacagatgggtaaataataggtatcctttcttggtgtctt |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16875871 |
attagtctatggttctcagctgtttgattaggaatatgaaatttcaactatctattatgttacagatgggtaaataataggtatcctttcttggtgtctt |
16875772 |
T |
|
| Q |
114 |
cctttaacttcaacttgggcatgtgtaggtctagccccacgtgatttttgagtactaacaaaatactttcattgattgtgttgtgtggctgtactctttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16875771 |
cctttaacttcaacttgggcatgtgtaggtctagccccacgtgatttttgagtactaacaaaatactttcattgattgtgttgtgtggctgtactctttt |
16875672 |
T |
|
| Q |
214 |
c |
214 |
Q |
| |
|
| |
|
|
| T |
16875671 |
c |
16875671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 171 - 214
Target Start/End: Original strand, 16783139 - 16783182
Alignment:
| Q |
171 |
acaaaatactttcattgattgtgttgtgtggctgtactcttttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16783139 |
acaaaatactttcattgattgtgttgtgtggctgtaatcttttc |
16783182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 206
Target Start/End: Complemental strand, 38942244 - 38942209
Alignment:
| Q |
171 |
acaaaatactttcattgattgtgttgtgtggctgta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38942244 |
acaaaatactttcattgattgtgttgtgtggctgta |
38942209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0256 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0256
Description:
Target: scaffold0256; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 76
Target Start/End: Original strand, 10507 - 10554
Alignment:
| Q |
31 |
agctgtttgattaggaatatgaaatttcaac--tatctattatgttac |
76 |
Q |
| |
|
||||||||| | ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10507 |
agctgtttggtcaggaatatgaaatttcaactatatctattatgttac |
10554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University