View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2233_low_8 (Length: 220)
Name: NF2233_low_8
Description: NF2233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2233_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 14 - 198
Target Start/End: Original strand, 38763418 - 38763588
Alignment:
| Q |
14 |
aatctaacaaccacatttacaactacacctcttttttatactataaataaatgaatacatttctcaacttcttagttcactctcaattatcaatagtatc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38763418 |
aatctaacaaccacatttacaactacacctcttttttatactataaataaatgaatacatttctcaacttcttagttcactctcaattatcaatagtatc |
38763517 |
T |
|
| Q |
114 |
tcgttgcatgtctcacactacacattccaattaaagtttcattcactcgttggagcaattagctatattctgagtatgagtctta |
198 |
Q |
| |
|
|||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38763518 |
tcgttgcatgtc-ca-acta------------aaagtttcattcactcgttggagcaattagctatattctgagtatgtgtctta |
38763588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 178
Target Start/End: Complemental strand, 38762821 - 38762750
Alignment:
| Q |
107 |
tagtatctcgttgcatgtctcacactacacattccaattaaagtttcattcactcgttggagcaattagcta |
178 |
Q |
| |
|
||||||||| |||||||||||||| || ||||||| || ||||||| || |||||||||||||||||||| |
|
|
| T |
38762821 |
tagtatctcattgcatgtctcacaactcaaattccaactacagtttcactctctcgttggagcaattagcta |
38762750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University