View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2234_low_7 (Length: 211)
Name: NF2234_low_7
Description: NF2234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2234_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 45 - 196
Target Start/End: Original strand, 1824741 - 1824893
Alignment:
| Q |
45 |
caaaatgatgtttttatggggaatcactactttaattattt-gttttcacctcagttgttctaagcaatttgtcccaattatgggacagaaaatagttat |
143 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1824741 |
caaaatgatgttcttatggggaatcactactttaattattttgttttcatctcagttgttctaagcaatttgtcccaattatgggacagaaaatagttat |
1824840 |
T |
 |
| Q |
144 |
gaaattttgagtgcccaaaatgatttgtttttgtcaatttaacattttttact |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1824841 |
gaaattttgagtgcccaaaatgatttgtttttgtcaatttaacattttttact |
1824893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University