View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2235_low_11 (Length: 259)

Name: NF2235_low_11
Description: NF2235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2235_low_11
NF2235_low_11
[»] chr7 (5 HSPs)
chr7 (8-143)||(6849371-6849506)
chr7 (54-244)||(6889666-6889859)
chr7 (54-244)||(6844671-6844858)
chr7 (141-244)||(6849109-6849210)
chr7 (55-170)||(30597579-30597694)
[»] scaffold0210 (1 HSPs)
scaffold0210 (208-244)||(15863-15899)


Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 8 - 143
Target Start/End: Complemental strand, 6849506 - 6849371
Alignment:
8 tgagatgaaccaaaggagtatcctcattaatacaccccatacatagatcaatatttacatgtttgatggaagatagattgctctctctcccacgtagtct 107  Q
    ||||| |||| |||||||||||| ||| |||| ||||||||  || |||||||||||||||||||| |||||| |||||||||||||||||||||||| |    
6849506 tgagaagaacaaaaggagtatccgcatcaatagaccccatatttaaatcaatatttacatgtttgacggaagagagattgctctctctcccacgtagttt 6849407  T
108 cagatcaggaatatcccctgtacaaccaaagacaaa 143  Q
     |||| |||||||||||| |||||||||||||||||    
6849406 tagattaggaatatcccccgtacaaccaaagacaaa 6849371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 54 - 244
Target Start/End: Complemental strand, 6889859 - 6889666
Alignment:
54 atcaatatttacatgtttgatggaagatagattgctctctctcccacgtagtctcagatcaggaatatcccctgtacaaccaaagacaaaggtgcaaaga 153  Q
    |||||| |||||||||||||  ||||| |||||||||||| ||||| ||||| ||||| |||||| | | ||  ||||| ||||||||||||||||||||    
6889859 atcaatctttacatgtttgacagaagagagattgctctctatcccatgtagtttcagagcaggaaaacctccgatacaaacaaagacaaaggtgcaaaga 6889760  T
154 cttggagtagataactcgattttgccatattggt--ggtgatacact-tttaaagttaaattggcaagtgtagcacttgatatgcagaggtttt 244  Q
    ||||||||||||||||||||||||||||| | ||  |   |  || | | |||||||||||||||||||||||||||| |||| ||||||||||    
6889759 cttggagtagataactcgattttgccataattgtaggcccaaccagtgtctaaagttaaattggcaagtgtagcacttaatatccagaggtttt 6889666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 54 - 244
Target Start/End: Complemental strand, 6844858 - 6844671
Alignment:
54 atcaatatttacatgtttgatggaagatagattgctctctctcccacgtagtctcagatcaggaatatcccctgtacaaccaaagacaaaggtgcaaaga 153  Q
    |||||| |||||||||||||  ||||| ||||| |||||| ||||| ||||| ||||| ||||||||| |||   |||| ||||||||||||||||||||    
6844858 atcaatctttacatgtttgacagaagagagatttctctctatcccatgtagtttcagagcaggaatattcccctcacaaacaaagacaaaggtgcaaaga 6844759  T
154 cttggagtagataactcgattttgccatattggtggtgatacacttttaaagttaaattggcaagtgtagcacttgatatgcagaggtttt 244  Q
    ||||||||||||||||| |||||| ||||||  | ||| |    || || ||||||||   ||||||||||||||||||| ||||||||||    
6844758 cttggagtagataactcaattttgtcatatttattgtgtt---tttctatagttaaatcatcaagtgtagcacttgatatacagaggtttt 6844671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 141 - 244
Target Start/End: Complemental strand, 6849210 - 6849109
Alignment:
141 aaaggtgcaaagacttggagtagataactcgattttgccatattggtggtgatacacttttaaagttaaattggcaagtgtagcacttgatatgcagagg 240  Q
    |||||||||||||||||||||||||||||||||| ||||  ||| || |||||||  |||||||||||||||||||||||||||||||||||||||||||    
6849210 aaaggtgcaaagacttggagtagataactcgattatgccg-attagtagtgatacg-ttttaaagttaaattggcaagtgtagcacttgatatgcagagg 6849113  T
241 tttt 244  Q
    ||||    
6849112 tttt 6849109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 55 - 170
Target Start/End: Original strand, 30597579 - 30597694
Alignment:
55 tcaatatttacatgtttgatggaagatagattgctctctctcccacgtagtctcagatcaggaatatcccctgtacaaccaaagacaaaggtgcaaagac 154  Q
    |||||||||||||||||||  ||||| || ||| | |  |||| || |||| ||| | |||||||| || |   |||| ||||| |||||||| ||||||    
30597579 tcaatatttacatgtttgacagaagagaggttgattttgctcctacatagtttcaaaacaggaataccctcataacaaacaaagtcaaaggtgaaaagac 30597678  T
155 ttggagtagataactc 170  Q
    ||||||||||||||||    
30597679 ttggagtagataactc 30597694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0210
Description:

Target: scaffold0210; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 208 - 244
Target Start/End: Original strand, 15863 - 15899
Alignment:
208 aaattggcaagtgtagcacttgatatgcagaggtttt 244  Q
    |||||||||||||| |||||||||||| |||||||||    
15863 aaattggcaagtgtggcacttgatatgtagaggtttt 15899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University