View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2235_low_13 (Length: 243)
Name: NF2235_low_13
Description: NF2235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2235_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 6200981 - 6200853
Alignment:
| Q |
1 |
aagggaatatgataatgatttgccatttgatcatgcatctattcttcatagtcgtcttaagaagttttgcatgagtggagaacttttgtgtactgagaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6200981 |
aagggaatatgataatgatttgccatttgatcacgcgtttattcttcatagtcgtcttaagaagttttgcatgagtggagaacttttgtgtaccgagaat |
6200882 |
T |
 |
| Q |
101 |
ggcaaatatgtgtttgttgattgtgaaag |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6200881 |
ggcaaatatgtgtttgttgattgtgaaag |
6200853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 226
Target Start/End: Complemental strand, 6200801 - 6200771
Alignment:
| Q |
196 |
tactaacaatgtaaattattttcacactatc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6200801 |
tactaacaatgtaaattattttcacactatc |
6200771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 43367272 - 43367144
Alignment:
| Q |
1 |
aagggaatatgataatgatttgccatttgatcatgcatctattcttcatagtcgtcttaagaagttttgcatgagtggagaacttttgtgtactgagaat |
100 |
Q |
| |
|
|||| |||||||||| ||||| || ||||||||||||||||||||||||| || |||| ||||| ||||||||||||||||||||||||| || |||||| |
|
|
| T |
43367272 |
aaggcaatatgataaagatttaccgtttgatcatgcatctattcttcatattcatcttcagaagctttgcatgagtggagaacttttgtgcaccgagaat |
43367173 |
T |
 |
| Q |
101 |
ggcaaatatgtgtttgttgattgtgaaag |
129 |
Q |
| |
|
| ||||||||||||| |||||||||||| |
|
|
| T |
43367172 |
gagaaatatgtgtttgctgattgtgaaag |
43367144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University