View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2235_low_13 (Length: 243)

Name: NF2235_low_13
Description: NF2235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2235_low_13
NF2235_low_13
[»] chr4 (2 HSPs)
chr4 (1-129)||(6200853-6200981)
chr4 (196-226)||(6200771-6200801)
[»] chr7 (1 HSPs)
chr7 (1-129)||(43367144-43367272)


Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 6200981 - 6200853
Alignment:
1 aagggaatatgataatgatttgccatttgatcatgcatctattcttcatagtcgtcttaagaagttttgcatgagtggagaacttttgtgtactgagaat 100  Q
    ||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
6200981 aagggaatatgataatgatttgccatttgatcacgcgtttattcttcatagtcgtcttaagaagttttgcatgagtggagaacttttgtgtaccgagaat 6200882  T
101 ggcaaatatgtgtttgttgattgtgaaag 129  Q
    |||||||||||||||||||||||||||||    
6200881 ggcaaatatgtgtttgttgattgtgaaag 6200853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 226
Target Start/End: Complemental strand, 6200801 - 6200771
Alignment:
196 tactaacaatgtaaattattttcacactatc 226  Q
    |||||||||||||||||||||||||||||||    
6200801 tactaacaatgtaaattattttcacactatc 6200771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 43367272 - 43367144
Alignment:
1 aagggaatatgataatgatttgccatttgatcatgcatctattcttcatagtcgtcttaagaagttttgcatgagtggagaacttttgtgtactgagaat 100  Q
    |||| |||||||||| ||||| || ||||||||||||||||||||||||| || |||| ||||| ||||||||||||||||||||||||| || ||||||    
43367272 aaggcaatatgataaagatttaccgtttgatcatgcatctattcttcatattcatcttcagaagctttgcatgagtggagaacttttgtgcaccgagaat 43367173  T
101 ggcaaatatgtgtttgttgattgtgaaag 129  Q
    |  ||||||||||||| ||||||||||||    
43367172 gagaaatatgtgtttgctgattgtgaaag 43367144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University