View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2235_low_18 (Length: 227)
Name: NF2235_low_18
Description: NF2235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2235_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 120 - 209
Target Start/End: Original strand, 2832978 - 2833067
Alignment:
| Q |
120 |
gatgtacaatacaccatatagccgtcaaaacgacactccaacaaaccaccacctaggataacgccccaaccccacagacggggtcggagg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
2832978 |
gatgtacaatacaccatatagccgtcaaaacgacactccaacaaaccaccacctaggataacgccccaatcccacagacagggtcggagg |
2833067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 13 - 88
Target Start/End: Original strand, 2832869 - 2832946
Alignment:
| Q |
13 |
gagatgaaggaatttacagcttagatgggtccaattggcaagccgtcgactca--tttttcttcttcttttgtatggc |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||||| ||||| ||||||||||||||||| |
|
|
| T |
2832869 |
gagatgaaggaatttacagcttagatgggtccaattggcaaggcgtagactcattttttttttcttcttttgtatggc |
2832946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University