View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2235_low_7 (Length: 313)

Name: NF2235_low_7
Description: NF2235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2235_low_7
NF2235_low_7
[»] chr1 (1 HSPs)
chr1 (113-305)||(39229390-39229582)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 113 - 305
Target Start/End: Original strand, 39229390 - 39229582
Alignment:
113 ataggttgatttggatttgggaaattatgagcgttttcttgatgttacacttacaaaggataataatattactactggcaaaatatatcaggtgcatgct 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39229390 ataggttgatttggatttgggaaattatgagcgttttcttgatgttacacttacaaaggataataatattactactggcaaaatatatcaggtgcatgct 39229489  T
213 tgtttcattttatgttatggatttcattaattaatactcaactttatgctaattttgctttatggtttcatgtgattatttttagtctgtgct 305  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39229490 tgtttcattttatgttatggatttcattaattaatactcaactttatgctaattttgctttatggtttcatgtgattatttttagtctgtgct 39229582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University