View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2235_low_8 (Length: 290)
Name: NF2235_low_8
Description: NF2235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2235_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 39229559 - 39229836
Alignment:
| Q |
1 |
atgtgattatttttagtctgtgcttgagaaggagcgcaaaggagattatctcggaaaaactgttcaggtgataaatcgtgcgcgtgtttgtgctatttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39229559 |
atgtgattatttttagtctgtgcttgagaaggagcgcaaaggagattatctcggaaaaactgttcaggtgataaatcgtgcacgtgtttgtgctatttat |
39229658 |
T |
|
| Q |
101 |
acttgttaattgattgctgaataatggatattttgtgtggataatgaagataagattactgagttgttgagannnnnnnngatgaaataggtggttccgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
39229659 |
acttgttaattgattgctgaataatggatattttgtgtggataatgaagataagattactgagctgttgagattttttttgatgaaataggtggttccgc |
39229758 |
T |
|
| Q |
201 |
atatcaccgatgcaatcagaaactggattgaatcggttgctgtgatcccggttgatggaaatgaagaccctgctgatg |
278 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39229759 |
atatcactgatgcaatcagaaactggattgaatcggttgctgtgatcccggttgatggaaatgaagaccctgctgatg |
39229836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 11 - 69
Target Start/End: Original strand, 26519449 - 26519507
Alignment:
| Q |
11 |
ttttagtctgtgcttgagaaggagcgcaaaggagattatctcggaaaaactgttcaggt |
69 |
Q |
| |
|
||||||||||| ||||||||||| | | |||||||||||| ||||| ||||||||||| |
|
|
| T |
26519449 |
ttttagtctgttattgagaaggagagaagaggagattatcttggaaagactgttcaggt |
26519507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University