View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2236_high_1 (Length: 249)
Name: NF2236_high_1
Description: NF2236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2236_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 9084642 - 9084883
Alignment:
| Q |
1 |
cagaatgcaagggtttaaggaaatataccagcatcccacgatgtttgaatgtaactattggaaaagggaatcttgcatacacaaagctacgagttacgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9084642 |
cagaatgcaagggtttaaggaaatataccagcatcccacgatgtttgaatgtaactattggaaaagggaatcttgcatacacaaagctacgagttatgaa |
9084741 |
T |
|
| Q |
101 |
tataaaattcgctgatttcataatttaaaggaacatctcacaaaaatcaaggacttcttgatctctctttggcaaccacaattttgataagggctagggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9084742 |
tataaaattcgctgatttcataatttaaaggaacatctcacaaaaatcaaggacttcttgatctctctttggcaaccacaattttgataagggctagggt |
9084841 |
T |
|
| Q |
201 |
ttttgtgagccttcaaacaccactaatcatagtttcatctca |
242 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9084842 |
tcttgtgagccttcaaacaccactaatcatagtttcatctca |
9084883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 9079563 - 9079612
Alignment:
| Q |
1 |
cagaatgcaagggtttaaggaaatataccagcatcccacgatgtttgaat |
50 |
Q |
| |
|
|||| ||||||||||||||||||| | | |||||||||||||| |||||| |
|
|
| T |
9079563 |
cagattgcaagggtttaaggaaattttctagcatcccacgatgcttgaat |
9079612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University