View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2237_high_8 (Length: 212)
Name: NF2237_high_8
Description: NF2237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2237_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 36127417 - 36127595
Alignment:
| Q |
15 |
aaaggaaaagtgcgatactctgatgaggaaagggaaattcttgcgagcgaatcgaccaatccaacgattgagcaggccttcaatgtcgtcacggagagtg |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36127417 |
aaaggtaaagtgcgatactctgatgaggaaagggaaattcttgcgagcgaatcgaccaatccaacgattgagcaggccttcaatgtcgtcacggagagtg |
36127516 |
T |
 |
| Q |
115 |
agggagaggacggagtcgacgacctccgacacggtccaatccttttggaagcgcttaccggcaacacggaggcggtagt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36127517 |
agggagaggacggagtcgacgacctccgacacggtccaatccttttggaagcggttaccggcaacacggaggcggtagt |
36127595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University