View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2237_low_6 (Length: 267)
Name: NF2237_low_6
Description: NF2237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2237_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 91 - 179
Target Start/End: Original strand, 8008383 - 8008471
Alignment:
| Q |
91 |
ttttattcagagaccattttctttccttgtaaatgactcttataaatagggatgagtttagtctataaaagaggaaaatatctttcctt |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8008383 |
ttttattcagagaccattttctttccttgtaaataactcttataaatagggatgagtttagtctataaaagaggaaaatatctttcctt |
8008471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 45
Target Start/End: Original strand, 8008305 - 8008337
Alignment:
| Q |
13 |
aatatattaaatacaagggaaatgtatttttgg |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8008305 |
aatatattaaatacaagggaaatgtatttttgg |
8008337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University