View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2238_low_11 (Length: 235)
Name: NF2238_low_11
Description: NF2238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2238_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 6424878 - 6424676
Alignment:
| Q |
18 |
tctacatttgcatgctatttttcgcaatatcaaagactgcgacataactttttactgcaatattagttctaaattgcagtcgctgacgaagttgtggtta |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6424878 |
tctacatttgcatgctatttttcacaatatcaaagactgcgacataactttttactgcaatattagttctaaattgcagtcgctgacgaagttgtggtta |
6424779 |
T |
 |
| Q |
118 |
tgctgtgaaccttgacactgcagtaaattgcagacaaatgtagtcaatgcagccacaattgaagttgcggtgccatttcaaagatctataaaacctttat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6424778 |
tgctgtgaaccttgacactgcagtaaattgcagacaaatgtagtcgatgcagccacaattgaagttgcggtgccatttcaaagacctataaaacctttat |
6424679 |
T |
 |
| Q |
218 |
att |
220 |
Q |
| |
|
||| |
|
|
| T |
6424678 |
att |
6424676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University