View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2239_high_9 (Length: 260)
Name: NF2239_high_9
Description: NF2239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2239_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 12 - 247
Target Start/End: Complemental strand, 50016720 - 50016486
Alignment:
| Q |
12 |
agacatgggaacgggtttataaaaagaactgtggtccacacatttattacaacccgatttttaattgttattaagggactatgtgctcatcaaagtaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50016720 |
agacatgggaacgggtttataaaaagaactgtggtccacacatttattacaacccgatttttaattgttattaagggactatgtgctcatcaaagtaaca |
50016621 |
T |
 |
| Q |
112 |
aagcttattcaaaacttgaaattatcccatacaaacattacaatgtgaaaactggaacacaagggggtgaatccaattagttacccccaacccgcaacag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50016620 |
aagcttattcaaaacttgaaattatcccatacaaacattacaatgtgaaaactggaacacaagggggtgaatccaattagttacccccaaccggcaacag |
50016521 |
T |
 |
| Q |
212 |
caagcacaatgaaagttacaatttgtagttgaaatt |
247 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50016520 |
caagcacaatg-aagttacaatttgtagttgaaatt |
50016486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University