View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2239_low_11 (Length: 256)
Name: NF2239_low_11
Description: NF2239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2239_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 24 - 245
Target Start/End: Original strand, 40397379 - 40397600
Alignment:
| Q |
24 |
agattttcttgcaaagttgtttgtcatcttagtaccaa--atcacctttctgtctttcagctctcaaattcatattcatttttctactattannnnnnnn |
121 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
40397379 |
agattttcttgcaaagttgtttgtcctcttagtaccaacaatcacctttctgtctttcagctctcaaattcatattcatttttctactttaatttttttt |
40397478 |
T |
|
| Q |
122 |
nncttttccaaaccaaacatattcaactttcaagtcatatctagggctttatttttcgtattccaacatgtatattggatttatttgtcatatgcatttg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40397479 |
t--ttttccaaaccaaacatattcaactttcaagtcatatctagggctttatttttcgtattccaacatgtatattggatttatttgtcatatgcatttg |
40397576 |
T |
|
| Q |
222 |
gcgtcttccgtatacacaggttct |
245 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40397577 |
gcgtcttccgtatacacaggttct |
40397600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University