View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2240_high_23 (Length: 286)
Name: NF2240_high_23
Description: NF2240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2240_high_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 277
Target Start/End: Complemental strand, 15056850 - 15056590
Alignment:
| Q |
17 |
aaaaacagtattagttttcaaaaaactaaagcggatgtttgcaaaagacacttcgaaagtcaagtccaatgaggtgctagcagatagcaaatggatttgg |
116 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| ||||||||||||||| |||| |||||||| | ||||||| ||||||||||||||||| |||| |
|
|
| T |
15056850 |
aaaaacactattggttttcaaaaaactaaagcggatgcttgcaaaagacacttggaaaatcaagtccgacgaggtgccagcagatagcaaatggacttgg |
15056751 |
T |
|
| Q |
117 |
ttcatgagtttttgtgatgataaaagtgaaattattatacttggggtgcgatgccttctatttatggggttgatctgataacgagttctttgttggttta |
216 |
Q |
| |
|
|| ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||| |
|
|
| T |
15056750 |
ttaatgagtttttgtgatgataaaagtggaattattgtacttggggtgcgatgccttctatttatgtggttgatctgataaagagttctttattggttta |
15056651 |
T |
|
| Q |
217 |
aatcttctctccttagctttagtatggtttgttataaggttacttcagatatcagaataat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||| |
|
|
| T |
15056650 |
aatcttctctccttagctttagtatggtttgttacgaggttactccagatatcagagtaat |
15056590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University