View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2240_high_30 (Length: 239)
Name: NF2240_high_30
Description: NF2240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2240_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 3 - 146
Target Start/End: Original strand, 35159520 - 35159663
Alignment:
| Q |
3 |
cataggcttgaatatgaccgtaggagtattatcaagttgagaaaaactcgaagcatgtactacatcccaaaacaatatatgttactgtgatggtttattg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
35159520 |
cataggcttgaatatgaccgtaggagtattatcaagttgagaaaaactcgaagcatgtactacatcccaaaacaatatatgttattttgatggtttattg |
35159619 |
T |
 |
| Q |
103 |
agtttgatggttgatgcatttgagacatggtttctcaggtgctt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35159620 |
agtttgatggttgatgcatttgagacatggtttctcacgtgctt |
35159663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University