View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2240_low_37 (Length: 215)
Name: NF2240_low_37
Description: NF2240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2240_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 205
Target Start/End: Complemental strand, 51009087 - 51008900
Alignment:
| Q |
18 |
aaatcaacaaattagcatcacaattaatttgacaaattagcatcacaattaatgtaatgttatgtatataagttataacctttgatcttcacttaatttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51009087 |
aaatcaacaaattagcatcacaattaatttgacaaattagcatcacaattaatgtaatgtaatgtatataagttataacctttgatcttcacttaatttc |
51008988 |
T |
|
| Q |
118 |
cagtagacacagtaatcccagccattcaaaccaacaagaggtcttaatctttcagtaatgttttgcatgatgaaattgttcatctcac |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51008987 |
cagtagacacagtaatcccagccattcaaaccaacaagaggtcttaatctttcagtaatgttttgcatgatgaaattgttcatgtcac |
51008900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University