View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2241_low_13 (Length: 255)
Name: NF2241_low_13
Description: NF2241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2241_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 59 - 242
Target Start/End: Complemental strand, 36645770 - 36645587
Alignment:
| Q |
59 |
gaaggttccttcaagtccagacccaatacacaatagcgacagtgtttccgttgaggatgaaaacaaaccataaatcggaagggtgaggatggtttcttca |
158 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
36645770 |
gaaggttcctacaagtccagacccaatacacaatagcgacagtgtttccgttgaggatgaaaacaaaccacaaatcggaagggcgaggatggtttcttca |
36645671 |
T |
 |
| Q |
159 |
ggtccaaacccattacacaatagacttgttaactctgttggaactaaaaacatgccataaatcgggggattgggaatgattcct |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36645670 |
ggtccaaacccattacacaatagactcattaactctgttggaactaaaaacatgccataaatcgggggattggggatgattcct |
36645587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 13 - 152
Target Start/End: Complemental strand, 36645991 - 36645851
Alignment:
| Q |
13 |
tcatcaagaatcaaatatggggaaaac-cagaaattggagaattgcggaaggttccttcaagtccagacccaatacacaatagcgacagtgtttccgttg |
111 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||| |
|
|
| T |
36645991 |
tcatcaagaatcaaatatggggaaaagacagaaattggagaattgcggaaggttccttcaagtccagacccaatacacaatagcgacattgactccattg |
36645892 |
T |
 |
| Q |
112 |
aggatgaaaacaaaccataaatcggaagggtgaggatggtt |
152 |
Q |
| |
|
|||||||||||||| || |||||||| || |||||| |||| |
|
|
| T |
36645891 |
aggatgaaaacaaatcacaaatcggagggttgaggaaggtt |
36645851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University