View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2241_low_8 (Length: 318)
Name: NF2241_low_8
Description: NF2241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2241_low_8 |
 | |
|
| [»] scaffold0256 (2 HSPs) |
| | |
|
| [»] scaffold0133 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0256 (Bit Score: 114; Significance: 8e-58; HSPs: 2)
Name: scaffold0256
Description:
Target: scaffold0256; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 74 - 213
Target Start/End: Original strand, 10492 - 10628
Alignment:
| Q |
74 |
gcaagtgtataatttagctgctgtttggtcaggaatatgaaatttcaactatatctattatgttactttcatgcactattgttaatctcaaaataatagg |
173 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10492 |
gcaagtgtataatttagctg---tttggtcaggaatatgaaatttcaactatatctattatgttactttcatgcactattgtttatctcaaaataatagg |
10588 |
T |
|
| Q |
174 |
tatcctttcttggcgtctttctttaatattctagagagaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
10589 |
tatcctttcttggcgtctttctttaatactctagacagaa |
10628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0256; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 10447 - 10497
Alignment:
| Q |
1 |
ttatttaatatttcaagttggcagtgtacctgaagttcaagtggatcaagt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
10447 |
ttatttaatatttcaagttggcagtgtacctcaagtgcaagtggagcaagt |
10497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0133 (Bit Score: 93; Significance: 3e-45; HSPs: 3)
Name: scaffold0133
Description:
Target: scaffold0133; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 158 - 262
Target Start/End: Original strand, 14271 - 14375
Alignment:
| Q |
158 |
atctcaaaataataggtatcctttcttggcgtctttctttaatattctagagagaacctcaacttttaaggactattcgtcttaacgttagttttattat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14271 |
atctcaaaataataggtatcctttcttggcgtctttctttaatactctagacagaacctcaacttttaaggactattcgtcttaatgttagttttattat |
14370 |
T |
|
| Q |
258 |
aataa |
262 |
Q |
| |
|
||||| |
|
|
| T |
14371 |
aataa |
14375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0133; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 14169 - 14261
Alignment:
| Q |
1 |
ttatttaatatttcaagttggcagtgtacctgaagttcaagtggatcaagtatggtgggatggcatcaagttggcaagtgtataatttagctg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14169 |
ttatttaatatttcaagttggcagtgtacctgaagtgcaagtggatcaagtatggtgggatggtatcaagttggcaagtgtataatttagctg |
14261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0133; HSP #3
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 9830 - 9909
Alignment:
| Q |
1 |
ttatttaatatttcaagttggcagtgtacctgaagttcaagtggatcaagtatggtgggatggcatcaagttggcaagtg |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9830 |
ttatttaatatttcaagttggcagtgtacctgaagtgcaagtggatcaagtatggtgggatggcatcaagttggcaagtg |
9909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 299
Target Start/End: Complemental strand, 38942289 - 38942246
Alignment:
| Q |
256 |
ataataaacataattttttggaatatttactgcagacaagttat |
299 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
38942289 |
ataataaacataattttttggaatactaactgcagacaagttat |
38942246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University