View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2242-Insertion-3 (Length: 294)
Name: NF2242-Insertion-3
Description: NF2242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2242-Insertion-3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 1e-47; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 8 - 108
Target Start/End: Original strand, 442135 - 442235
Alignment:
| Q |
8 |
aatcacatttataaatatatatgagtatacatcttaagactatgcttgatttgataatttaatttaattcattagtaccactaaattagttacttccttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
442135 |
aatcacatttataaatatatatgagtatacatctcaagactatgcttgatttgataatttaatttaattcattagtaccactaaattagttacttccttc |
442234 |
T |
|
| Q |
108 |
c |
108 |
Q |
| |
|
| |
|
|
| T |
442235 |
c |
442235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 210 - 294
Target Start/End: Original strand, 442339 - 442423
Alignment:
| Q |
210 |
ggttgttgaacaatttaataaacggattacaaatacgagtaaaagttatgacgagattagactttgttaattgttcattcagtgg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
442339 |
ggttgttgaacaatttaataaacggattacaaatacgagtaaaagttatgacaagattagactttgttaattgttcattcagtgg |
442423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 101
Target Start/End: Original strand, 443967 - 444012
Alignment:
| Q |
56 |
atttgataatttaatttaattcattagtaccactaaattagttact |
101 |
Q |
| |
|
|||| |||||| || ||||||||||||||||||| ||||||||||| |
|
|
| T |
443967 |
atttaataattcaagttaattcattagtaccacttaattagttact |
444012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University