View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2242-Insertion-4 (Length: 169)
Name: NF2242-Insertion-4
Description: NF2242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2242-Insertion-4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 9e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 9e-87
Query Start/End: Original strand, 8 - 169
Target Start/End: Complemental strand, 6032574 - 6032413
Alignment:
| Q |
8 |
tcttcaactttctcttaatcacaatagattcctcaatgaagttaaagatatcatctctttgaagtgattttgaagtttcatcttcattaggcatcaattg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032574 |
tcttcaactttctcttaatcacaatagattcctcaatgaagttaaagatatcatctctttgaagtgattttgaagtttcatcttcattaggcatcaattg |
6032475 |
T |
|
| Q |
108 |
atgaaggatttgttgattttgatcaatttcaggatatttttctttcaaatcttcttgcatct |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6032474 |
atgaaggatttgttgattttgatcaatttcaggatatttttctttcaaatcttcttgcatct |
6032413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University