View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2242-Insertion-6 (Length: 154)
Name: NF2242-Insertion-6
Description: NF2242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2242-Insertion-6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 8 - 154
Target Start/End: Original strand, 42244382 - 42244528
Alignment:
| Q |
8 |
atgtgcccagctgtttctaatcttaagtttttcattttataaaagtttatttattatcaaagactttgtcccatttttgctgctacttttttataaagtc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42244382 |
atgtgcccagctgtttctaatcttaagtttttcattttataaaagtttatttattatcaaagattttagcccatttttgctgctacttttttataaagtc |
42244481 |
T |
 |
| Q |
108 |
agtgatattgcaaatatgctttctcaaattttcatacttttttggtc |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42244482 |
agtgatattgcaaatatgctttctcaaattttcatacttttttggtc |
42244528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University