View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2242-Insertion-7 (Length: 83)
Name: NF2242-Insertion-7
Description: NF2242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2242-Insertion-7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 1e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 1e-34
Query Start/End: Original strand, 7 - 80
Target Start/End: Complemental strand, 614070 - 613997
Alignment:
| Q |
7 |
aaagtcttcatacttctgaacttgcacagtcaccccacggaaatcattcatggcaaaccacgtcttcatcgcag |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
614070 |
aaagtcttcatacttctgaacttgcacagtcaccccacggaaatcattcatggcaaaccacgtcttcatcgcag |
613997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 8 - 77
Target Start/End: Complemental strand, 4619989 - 4619920
Alignment:
| Q |
8 |
aagtcttcatacttctgaacttgcacagtcaccccacggaaatcattcatggcaaaccacgtcttcatcg |
77 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||| |||||||| |
|
|
| T |
4619989 |
aagtcttcatacttctgaacttccacagtcaccccacgaaagtcattcatggcaaaccacgccttcatcg |
4619920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University