View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2242R-Insertion-17 (Length: 208)
Name: NF2242R-Insertion-17
Description: NF2242R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2242R-Insertion-17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 9 - 176
Target Start/End: Complemental strand, 35591663 - 35591496
Alignment:
| Q |
9 |
ggatcaaagtatatggagcattgaagttggtcgattccacgcatatactttggaagatgctgagatcttagttacaattaaacccttttacctttgcttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35591663 |
ggatcaaagtatatggagcattgaagttggtcgattccacgcatatactttggaagatgctgagatctgagttacaattaaacccttttacctttgcttt |
35591564 |
T |
|
| Q |
109 |
ttcttctttatatacccttcctaccactatgctactatacaccaacatagttcctttattattccaca |
176 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35591563 |
ttcttctttataaacccttccaaccactatgctactatacaccaacatagttcctttattattccaca |
35591496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University