View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2242R-Insertion-19 (Length: 138)
Name: NF2242R-Insertion-19
Description: NF2242R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2242R-Insertion-19 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 9 - 138
Target Start/End: Original strand, 16352820 - 16352950
Alignment:
| Q |
9 |
caaagaagtagcttcctgcaggatccactgagattcaacccttgtcgcttagactggttttattc-aaaagcgaagatgggagggtgtttttcttcaaga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16352820 |
caaagaagtagcttcctgcaggatccactgagattcaacccttgtcgcttagactggttttattcaaaaagcgaagatgggagggtgtttttcttcaaga |
16352919 |
T |
 |
| Q |
108 |
tcatcatgcacatcaaagaaaatccgtttgg |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16352920 |
tcatcatgcacatcaaagaaaatccgtttgg |
16352950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University