View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2242R-Insertion-20 (Length: 135)
Name: NF2242R-Insertion-20
Description: NF2242R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2242R-Insertion-20 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 135
Target Start/End: Complemental strand, 41429513 - 41429385
Alignment:
| Q |
8 |
aatatttctaataaggatattgaaaatgttcctgataattgaccttcatttttt-ctttgtagttgtgtatgatatttggaaagatcagaatgatcttgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41429513 |
aatatttctaataaggatattgaaaatgttcctgataattgacctttatttttttctttgtagttgtgtacgatatttggaaagatcagaatgatcttgt |
41429414 |
T |
 |
| Q |
107 |
tttttctcagtcttcttccatatgtaact |
135 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41429413 |
tttttctcagtcttcttccatatgtaact |
41429385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University