View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2242R-Insertion-22 (Length: 119)
Name: NF2242R-Insertion-22
Description: NF2242R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2242R-Insertion-22 |
 |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 78; Significance: 8e-37; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 78; E-Value: 8e-37
Query Start/End: Original strand, 9 - 119
Target Start/End: Original strand, 174883 - 174993
Alignment:
| Q |
9 |
gctagaacaatcattggtcattgtataatggtttaataccnnnnnnnttactgatcgtattatgatagtttaaacttgatttttgtaaaagtctcctaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
174883 |
gctagaacaatcattggtcattgtataatggtttaataccaaaaaaattattgatcgtattatgatagtttaaacttgatttttgtaaaagtcttctaga |
174982 |
T |
 |
| Q |
109 |
aaagttggccc |
119 |
Q |
| |
|
||||||||||| |
|
|
| T |
174983 |
aaagttggccc |
174993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 78; E-Value: 8e-37
Query Start/End: Original strand, 9 - 119
Target Start/End: Original strand, 180396 - 180506
Alignment:
| Q |
9 |
gctagaacaatcattggtcattgtataatggtttaataccnnnnnnnttactgatcgtattatgatagtttaaacttgatttttgtaaaagtctcctaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
180396 |
gctagaacaatcattggtcattgtataatggtttaataccaaaaaaattattgatcgtattatgatagtttaaacttgatttttgtaaaagtcttctaga |
180495 |
T |
 |
| Q |
109 |
aaagttggccc |
119 |
Q |
| |
|
||||||||||| |
|
|
| T |
180496 |
aaagttggccc |
180506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University