View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2242R-Insertion-23 (Length: 114)
Name: NF2242R-Insertion-23
Description: NF2242R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2242R-Insertion-23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 2e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 12 - 114
Target Start/End: Complemental strand, 44659168 - 44659066
Alignment:
| Q |
12 |
atggttggtaatttaaactttttcagcacaagtacccttgtctctgatcaacgacgtgtaattcatcggaaaagcacgtttatcttttcttgtatacagt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44659168 |
atggttggtaatttaaactttttcagcacaagtacccttgtctctgatcgacgacgtgtaattcatcggaaaagcacgtttatcttttcttgtatacagt |
44659069 |
T |
 |
| Q |
112 |
ctg |
114 |
Q |
| |
|
||| |
|
|
| T |
44659068 |
ctg |
44659066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University