View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2242R-Insertion-25 (Length: 55)
Name: NF2242R-Insertion-25
Description: NF2242R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2242R-Insertion-25 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 43; Significance: 2e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 2e-16
Query Start/End: Original strand, 9 - 55
Target Start/End: Original strand, 46222280 - 46222326
Alignment:
| Q |
9 |
taatcatcactgaatcccattctcaatctcatcctccgtttctaggg |
55 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46222280 |
taattatcactgaatcccattctcaatctcatcctccgtttctaggg |
46222326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University